First Report of Tomato spotted wilt virus Infecting Cowpea in China

Cowpea (Vigna unguiculata) is widely cultivated in China as vegetable crops, with at least 0.33 million ha (10% of vegetables planted) annually. Over 140 viruses have been reported infecting cowpea (Aliyu and Balogun 2011). In July 2014, cowpea leaves showing mottling, shrinking, chlorosis, necrotic concentric rings, and yellow vein were observed in fields in Dali and Dehong autonomous prefectures, Yunnan Province, China. The disease incidence based on symptom observation was 1 to 3%. Leaf samples were initially collected from 12 diseased plants and tested by dot-enzyme linked immunosorbent assay (dot-ELISA) using six antisera of Cucumber mosaic virus, Tobacco mosaic virus, Cucumber green mottle mosaic virus, Turnip mosaic virus, Broad bean wilt virus 2, and Tomato spotted wilt virus (TSWV) (kindly provided by Dr. Xueping Zhou of Zhejiang University, China), respectively. Two of the samples reacted positively with TSWV antibody but none of the 12 samples reacted with the antisera for the other 5 viruses. Total nucleotide acids were then extracted from these samples using a CTAB-based method (Li et al. 2008) and used as templates in reverse-transcription (RT)-PCR with TSWV-specific primer pair of TSWVF (TCACTGTAATGTTCCATAGCAA) and TSWVR (AGAGCAATYGTGTCAATTTTATTC) (Yin et al. 2013). An amplicon of expected size (815 bp) was obtained from the diseased samples. The amplicon of a selected isolate, YDL-JD3, was cloned and sequenced. BLAST search of the obtained sequence (GenBank Accession No. KR259539) revealed that this isolate had the highest nucleotide sequence identity of 100% with the segment S of a TSWV tomato isolate from China (HQ402595), confirming the serological result. To confirm TSWV as causal agent of the observed disease, plant saps of isolate YDL-JD3 were mechanically inoculated onto healthy cowpea seedlings. Foliage shrinking was observed on the inoculated plants 10 days past inoculation (dpi), and more typical symptoms such as chlorosis and concentric spots were observed at 20 dpi. The TSWV infection of the inoculated cowpea plants was further confirmed by RT-PCR and sequential sequencing. Cowpea plants with similar symptoms were also observed in Yuxi City of Yunnan and one of the plants was confirmed infecting with TSWV by dot-ELISA and RT-PCR. Our results showed that TSWV was a common causal agent of the cowpea viral diseases in Yunnan. TSWV is one of the most economically important plant viruses, and causes serious losses in numerous crops (Macharia et al. 2014). To our knowledge, this is the first report of TSWV infecting cowpea in China. © 2016 The American Phytopathological Society.