Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

Background beta-Thalassemia is mainly caused by point mutations in the beta-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed beta CD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed beta CD128-134) in family A and B, respectively. Both the two novel mutations lead to beta-thalassemia trait. However, when compounded with other beta 0-thalassemia, it may behave with beta-thalassemia intermedia or beta-thalassemia major.Conclusion Our study broadens the variants spectral of beta-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.